Never be afraid to get dirty, but be sufficiently sure-footed to avoid the abyss of contamination.

Alma Matters

At UC Berkeley, we’ll help you write your first essay: ACGTAGCGATCTAGCTGACTGCATGCTAGCTAGCATGCTAGCTGACTGT. Are you having difficulty deciphering it? Well, if you’ve been truthful, it describes a part of who you are:

Instead of the usual required summer-reading book, this year’s incoming freshmen at the University of California, Berkeley, will get something quite different: a cotton swab on which they can, if they choose, send in a DNA sample.

Is this really a wise investment of resources for a school facing budget cuts? And I thought BeenVerified.com would be the creepiest thing I would hear about this week.

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s